Ressources

Ressource: Mutant insertion KANMX 309

Ressource


Nom de la ressource : Mutant insertion KANMX 309

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta19g00420

Voir cette cible sur JBrowse
Lien :
Séquence début :
tctggcaggttttgtgggaatggtctgatacaagtgccggtagtgttgtgg
Chromosome : 19
Position de début : 108164
Position de fin : 108214
Voir sur JBrowse
Séquence transgene :
aaaaacaatcaagtgatgcatgcacgtgaaaaatgggcatttcaagtaaat
Chromosome : 19
Position de début : 1276
Position de fin : 1326
Voir sur JBrowse

Commander