Ressources

Ressource: Mutant insertion KANMX 306

Ressource


Nom de la ressource : Mutant insertion KANMX 306

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta19g00640

Voir cette cible sur JBrowse
Lien :
Séquence début :
cggcgcaaatctgaccagccttgtagtatccagccttgttcagcgtcgtcgtccccggaccgagctgtgcgacg
Chromosome : 19
Position de début : 159716
Position de fin : 159789
Voir sur JBrowse
Séquence transgene :
atatggcccgtacgaagcaaactgcccgtaagtccaccggtggcaaggccccgcgcaagcaactcgccaccaaggcggcccgcaagtccgccccggcgaccggc
Chromosome : 19
Position de début : 1437
Position de fin : 1540
Voir sur JBrowse

Commander