Ressources

Ressource: Mutant insertion KANMX 305

Ressource


Nom de la ressource : Mutant insertion KANMX 305

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta19g00640

Voir cette cible sur JBrowse
Lien :
Séquence début :
cgcgagacgattgaaaaacgccgcttggtcgcgacaccacgactcgtgcgc
Chromosome : 19
Position de début : 157227
Position de fin : 157277
Voir sur JBrowse
Séquence transgene :
gtccaccggtggcaaggccccgcgcaagcaactcgccaccaaggcggcccg
Chromosome : 19
Position de début : 1468
Position de fin : 1518
Voir sur JBrowse

Commander