Ressources

Ressource: Mutant insertion KANMX 304

Ressource


Nom de la ressource : Mutant insertion KANMX 304

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta19g00640

Voir cette cible sur JBrowse
Lien :
Séquence début :
ttcgtagcattcttcgtcgtcgtctcatcctcgttctcgacgtccttcgcg
Chromosome : 19
Position de début : 157156
Position de fin : 157206
Voir sur JBrowse
Séquence transgene :
ggtggcaaggccccgcgcaagcaactcgccaccaaggcggcccgcaagtcc
Chromosome : 19
Position de début : 1475
Position de fin : 1525
Voir sur JBrowse

Commander