Ressources

Ressource: Mutant insertion KANMX 303

Ressource


Nom de la ressource : Mutant insertion KANMX 303

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta19g00420

Voir cette cible sur JBrowse
Lien :
Séquence début :
tgtgtaacaagtttgtatcattggttttggccaatttagtactcagtggct
Chromosome : 19
Position de début : 107939
Position de fin : 107989
Voir sur JBrowse
Séquence transgene :
tgaatgctggtcgctatactgctgtcgattcgatactaacgccgccatcca
Chromosome : 19
Position de début : 16
Position de fin : 66
Voir sur JBrowse

Commander