Ressources

Ressource: Mutant insertion KANMX 285

Ressource


Nom de la ressource : Mutant insertion KANMX 285

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta10g03500

Voir cette cible sur JBrowse
Lien :
Séquence début :
aattccaagcctaaaccgaacgattctttagagcaaatgttggacgtgata
Chromosome : 10
Position de début : 565686
Position de fin : 565736
Voir sur JBrowse
Séquence transgene :
ttagtatcgaatcgacagcagtatagcgaccagcattcacatacgattgac
Chromosome : 10
Position de début : 28
Position de fin : 78
Voir sur JBrowse

Commander