Ressources

Ressource: Mutant insertion KANMX 281

Ressource


Nom de la ressource : Mutant insertion KANMX 281

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta07g00950

Voir cette cible sur JBrowse
Lien :
Séquence début :
taatgtcacgttcgcgttggcagaaacgctcgggacaccggacgcgctcgt
Chromosome : 7
Position de début : 127813
Position de fin : 127863
Voir sur JBrowse
Séquence transgene :
gcatttcaagtaaatagagagtaatgactcgtgtatgaccccctgctttcg
Chromosome : 7
Position de début : 1312
Position de fin : 1362
Voir sur JBrowse

Commander