Ressources

Ressource: Mutant insertion KANMX 280

Ressource


Nom de la ressource : Mutant insertion KANMX 280

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta05g04280

Voir cette cible sur JBrowse
Lien :
Séquence début :
gaagctccgcgcctccgagcgcgagatctaccagctcggaaccgcgctcgc
Chromosome : 5
Position de début : 694404
Position de fin : 694454
Voir sur JBrowse
Séquence transgene :
ggtggcaaggccccgcgcaagcaactcgccaccaaggcggcccgcaagtcc
Chromosome : 5
Position de début : 1475
Position de fin : 1525
Voir sur JBrowse

Commander