Ressources

Ressource: Mutant insertion KANMX 277

Ressource


Nom de la ressource : Mutant insertion KANMX 277

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta05g04260

Voir cette cible sur JBrowse
Lien :
Séquence début :
gacgcgcagcgcgttcggatcggcgaaacgcgcatcgacatccacgctcgc
Chromosome : 5
Position de début : 692536
Position de fin : 692586
Voir sur JBrowse
Séquence transgene :
gtgaatgctggtcgctatactgctgtcgattcgatactaacgccgccatcc
Chromosome : 5
Position de début : 17
Position de fin : 67
Voir sur JBrowse

Commander