Ressources

Ressource: Mutant insertion KANMX 271

Ressource


Nom de la ressource : Mutant insertion KANMX 271

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta02g01500

Voir cette cible sur JBrowse
Lien :
Séquence début :
aacgctctgtgtgaggcgagcgcagcgtcgccggttcgcaaacgtgctcga
Chromosome : 2
Position de début : 337794
Position de fin : 337844
Voir sur JBrowse
Séquence transgene :
aagcaaactgcccgtaagtccaccggtggcaaggccccgcgcaagcaactc
Chromosome : 2
Position de début : 1451
Position de fin : 1501
Voir sur JBrowse

Commander