Ressources

Ressource: Mutant insertion KANMX 270

Ressource


Nom de la ressource : Mutant insertion KANMX 270

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta02g01440

Voir cette cible sur JBrowse
Lien :
Séquence début :
tcatgcaactgcagaaaagtttggcccaacttttggccagttttggtttccagattctcgagttg
Chromosome : 2
Position de début : 331050
Position de fin : 331114
Voir sur JBrowse
Séquence transgene :
catcatctgcccagatgcgaagttaagtgcgcagaaagtaatatcatgcgtcaatcgtatg
Chromosome : 2
Position de début : 67
Position de fin : 127
Voir sur JBrowse

Commander