Ressources

Ressource: Mutant insertion KANMX 265

Ressource


Nom de la ressource : Mutant insertion KANMX 265

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta02g02340

Voir cette cible sur JBrowse
Lien :
Séquence début :
cctctctctttagagcacttggtgactccagaacgttgacctcaaagctgg
Chromosome : 2
Position de début : 473282
Position de fin : 473332
Voir sur JBrowse
Séquence transgene :
aacatcattggcaacgctacctttgccatgtttcagaaacaactctggcgca
Chromosome : 2
Position de début : 870
Position de fin : 921
Voir sur JBrowse

Commander