Ressources

Ressource: Mutant insertion KANMX 258

Ressource


Nom de la ressource : Mutant insertion KANMX 258

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta19g00420

Voir cette cible sur JBrowse
Lien :
Séquence début :
cgtactggtatcccacagaaaaggtccttcgcagttatccgccgcagtctg
Chromosome : 19
Position de début : 108211
Position de fin : 108261
Voir sur JBrowse
Séquence transgene :
accgataccaggatcttgccatcctatggaactgcctcggtgagttttctc
Chromosome : 19
Position de début : 344
Position de fin : 394
Voir sur JBrowse

Commander