Ressources

Ressource: Mutant insertion KANMX 252

Ressource


Nom de la ressource : Mutant insertion KANMX 252

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta19g00420

Voir cette cible sur JBrowse
Lien :
Séquence début :
ctacaatggaaatagtgctagttcaaccgttagaacaaggaactgcgttcctgtgctcctactcgtcgtgatatcaccgct
Chromosome : 19
Position de début : 108045
Position de fin : 108125
Voir sur JBrowse
Séquence transgene :
aaactgcccgtaagtccaccggtggcaaggccccgcgcaagcaactcgccaccaaggcggcccgcaagtccgc
Chromosome : 19
Position de début : 1455
Position de fin : 1527
Voir sur JBrowse

Commander