Ressources

Ressource: Mutant insertion KANMX 235

Ressource


Nom de la ressource : Mutant insertion KANMX 235

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta07g03670

Voir cette cible sur JBrowse
Lien :
Séquence début :
tggactgcaagttaaataccttaaggtgattgaaaaggagggttacacagcgttgccttgggttcggtatattacgcgctctg
Chromosome : 7
Position de début : 576874
Position de fin : 576956
Voir sur JBrowse
Séquence transgene :
tcgacagtcaatatggcccgtacgaagcaaactgcccgtaagtccaccggtggcaaggccccgcgcaagcaactcgc
Chromosome : 7
Position de début : 1427
Position de fin : 1503
Voir sur JBrowse

Commander