Ressources

Ressource: Mutant insertion KANMX 234

Ressource


Nom de la ressource : Mutant insertion KANMX 234

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta07g03670

Voir cette cible sur JBrowse
Lien :
Séquence début :
atgaggtatttttagatgtgattgagagctgtagcttgtttgtggatgctc
Chromosome : 7
Position de début : 576207
Position de fin : 576257
Voir sur JBrowse
Séquence transgene :
cgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataagct
Chromosome : 7
Position de début : 511
Position de fin : 561
Voir sur JBrowse

Commander