Ressources

Ressource: Mutant insertion KANMX 231

Ressource


Nom de la ressource : Mutant insertion KANMX 231

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta06g04620

Voir cette cible sur JBrowse
Lien :
Séquence début :
acgagtttcatctttttcttcttcgccctgacctcgcccgcgtcgtgcgcg
Chromosome : 6
Position de début : 788278
Position de fin : 788328
Voir sur JBrowse
Séquence transgene :
atcgcacggcgtcgtcacaactcgacagtcaatatggcccgtacgaagcaa
Chromosome : 6
Position de début : 1406
Position de fin : 1456
Voir sur JBrowse

Commander