Ressources

Ressource: Mutant insertion KANMX 230

Ressource


Nom de la ressource : Mutant insertion KANMX 230

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta06g04620

Voir cette cible sur JBrowse
Lien :
Séquence début :
gctctcacttcgttagcctttgctttttcgcgcaacttttgcttccaaagc
Chromosome : 6
Position de début : 788215
Position de fin : 788265
Voir sur JBrowse
Séquence transgene :
gtatgaccccctgctttcgaactcaccgactcaccggcgcgcgcggtgaaa
Chromosome : 6
Position de début : 1344
Position de fin : 1394
Voir sur JBrowse

Commander