Ressources

Ressource: Mutant insertion KANMX 229

Ressource


Nom de la ressource : Mutant insertion KANMX 229

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta06g01280

Voir cette cible sur JBrowse
Lien :
Séquence début :
ctggtactacatgcagaagaccatggaaggattgcgcattagcatgtttga
Chromosome : 6
Position de début : 198153
Position de fin : 198203
Voir sur JBrowse
Séquence transgene :
gaagttaagtgcgcagaaagtaatatcatgcgtcaatcgtatgtgaatgct
Chromosome : 6
Position de début : 59
Position de fin : 109
Voir sur JBrowse

Commander