Ressources

Ressource: Mutant insertion KANMX 227

Ressource


Nom de la ressource : Mutant insertion KANMX 227

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta06g00380

Voir cette cible sur JBrowse
Lien :
Séquence début :
gcgggtgttggttcaagcgacagtgagctgcaacgcgcgattcgagagagc
Chromosome : 6
Position de début : 62979
Position de fin : 63029
Voir sur JBrowse
Séquence transgene :
tcacaactcgacagtcaatatggcccgtacgaagcaaactgcccgtaagtc
Chromosome : 6
Position de début : 1420
Position de fin : 1470
Voir sur JBrowse

Commander