Ressources

Ressource: Mutant insertion KANMX 226

Ressource


Nom de la ressource : Mutant insertion KANMX 226

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta04g01810

Voir cette cible sur JBrowse
Lien :
Séquence début :
atcacgcaatccgcgcctcgatagaacgagacgccgagcgactgaaaccgc
Chromosome : 4
Position de début : 273634
Position de fin : 273684
Voir sur JBrowse
Séquence transgene :
tcatgcgtcaatcgtatgtgaatgctggtcgctatactgctgtcgattcg
Chromosome : 4
Position de début : 35
Position de fin : 84
Voir sur JBrowse

Commander