Ressources

Ressource: Mutant insertion KANMX 225

Ressource


Nom de la ressource : Mutant insertion KANMX 225

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta03g05500

Voir cette cible sur JBrowse
Lien :
Séquence début :
gccaacgaagtcgatcgcttcaacaagatcgtgctcggtaagtaaactcgg
Chromosome : 3
Position de début : 894860
Position de fin : 894910
Voir sur JBrowse
Séquence transgene :
taatcaaatgttagcgtgatttatattttttttcgcctcgacatcatctgc
Chromosome : 3
Position de début : 118
Position de fin : 168
Voir sur JBrowse

Commander