Ressources

Ressource: Mutant insertion KANMX 224

Ressource


Nom de la ressource : Mutant insertion KANMX 224

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta03g05500

Voir cette cible sur JBrowse
Lien :
Séquence début :
acgccttggttcttggtgaactgctggtacacatccggaacgaggccac
Chromosome : 3
Position de début : 895092
Position de fin : 895140
Voir sur JBrowse
Séquence transgene :
gaaatgcataagcttttgccattctcaccggattcagtcgtcactcatggt
Chromosome : 3
Position de début : 474
Position de fin : 524
Voir sur JBrowse

Commander