Ressources

Ressource: Mutant insertion KANMX 223

Ressource


Nom de la ressource : Mutant insertion KANMX 223

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta03g05500

Voir cette cible sur JBrowse
Lien :
Séquence début :
gaggtcttaccgccagctttttcgaccaagagaccgaacggagcggcctcg
Chromosome : 3
Position de début : 894990
Position de fin : 895040
Voir sur JBrowse
Séquence transgene :
taggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatc
Chromosome : 3
Position de début : 380
Position de fin : 430
Voir sur JBrowse

Commander