Ressources

Ressource: Mutant insertion KANMX 218

Ressource


Nom de la ressource : Mutant insertion KANMX 218

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta02g01360

Voir cette cible sur JBrowse
Lien :
Séquence début :
gtgggttcactggtgcaaaagaaaatgggctgttacagttggagggaaaag
Chromosome : 2
Position de début : 320745
Position de fin : 320795
Voir sur JBrowse
Séquence transgene :
gctggtcgctatactgctgtcgattcgatactaacgccgccatccagtgtc
Chromosome : 2
Position de début : 11
Position de fin : 61
Voir sur JBrowse

Commander