Ressources

Ressource: Mutant insertion KANMX 216

Ressource


Nom de la ressource : Mutant insertion KANMX 216

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta01g06130

Voir cette cible sur JBrowse
Lien :
Séquence début :
gatggaaccggcgtcgccgacgccctcaagtggctcgatgaggacaagtgggagaacgccccggagtacattcgccctcgtccgaagt
Chromosome : 1
Position de début : 987707
Position de fin : 987794
Voir sur JBrowse
Séquence transgene :
cctgctttcgaactcaccgactcaccggcgcgcgcggtgaaacgctcgattcgatcgcacggcgtcgtcacaactcgacagtcaata
Chromosome : 1
Position de début : 1353
Position de fin : 1439
Voir sur JBrowse

Commander