Ressources

Ressource: Mutant insertion KANMX 213

Ressource


Nom de la ressource : Mutant insertion KANMX 213

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta01g06130

Voir cette cible sur JBrowse
Lien :
Séquence début :
atcggagacgtgatcggcgtccaagagggcgtcgatgcgacgttggagatt
Chromosome : 1
Position de début : 987132
Position de fin : 987182
Voir sur JBrowse
Séquence transgene :
caaatgttagcgtgatttatattttttttcgcctcgacatcatctgcccag
Chromosome : 1
Position de début : 114
Position de fin : 164
Voir sur JBrowse

Commander