Ressources

Ressource: Mutant insertion KANMX 204

Ressource


Nom de la ressource : Mutant insertion KANMX 204

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta14g00070

Voir cette cible sur JBrowse
Lien :
Séquence début :
cgaccattcgtgtgtcgcttggtcgaacgagccgtaaagttcgtcgtttga
Chromosome : 14
Position de début : 17910
Position de fin : 17960
Voir sur JBrowse
Séquence transgene :
tcacaactcgacagtcaatatggcccgtacgaagcaaactgcccgtaagtc
Chromosome : 14
Position de début : 1420
Position de fin : 1470
Voir sur JBrowse

Commander