Ressources

Ressource: Mutant insertion KANMX 189

Ressource


Nom de la ressource : Mutant insertion KANMX 189

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta07g03670

Voir cette cible sur JBrowse
Lien :
Séquence début :
cttaaggtgattgaaaaggagggttacacagcgttgccttgggttcggtat
Chromosome : 7
Position de début : 576893
Position de fin : 576943
Voir sur JBrowse
Séquence transgene :
gtcacaactcgacagtcaatatggcccgtacgaagcaaactgcccgtaagt
Chromosome : 7
Position de début : 1419
Position de fin : 1469
Voir sur JBrowse

Commander