Ressources

Ressource: Mutant insertion KANMX 185

Ressource


Nom de la ressource : Mutant insertion KANMX 185

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta04g04550

Voir cette cible sur JBrowse
Lien :
Séquence début :
cgacgagcaccgctggcaaaacccggcgcgaccgttgaagaccatgttgca
Chromosome : 4
Position de début : 713072
Position de fin : 713122
Voir sur JBrowse
Séquence transgene :
ctggtcgctatactgctgtcgattcgatactaacgccgccatccagtgtcg
Chromosome : 4
Position de début : 10
Position de fin : 60
Voir sur JBrowse

Commander