Ressources

Ressource: Mutant insertion KANMX 184

Ressource


Nom de la ressource : Mutant insertion KANMX 184

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta03g02320

Voir cette cible sur JBrowse
Lien :
Séquence début :
caaggcggcgtggtcccagctacacaagccttggcaaatatcgatacgttc
Chromosome : 3
Position de début : 364330
Position de fin : 364380
Voir sur JBrowse
Séquence transgene :
gtatgtgaatgctggtcgctatactgctgtcgattcgatactaacgccgcc
Chromosome : 3
Position de début : 21
Position de fin : 71
Voir sur JBrowse

Commander