Ressources

Ressource: Mutant insertion KANMX 182

Ressource


Nom de la ressource : Mutant insertion KANMX 182

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta03g02330

Voir cette cible sur JBrowse
Lien :
Séquence début :
gcgtccaacgcgctcgagcgcaaacctttattcctagctattcgcactgtc
Chromosome : 3
Position de début : 366002
Position de fin : 366052
Voir sur JBrowse
Séquence transgene :
cgtggatttaaaaacaatcaagtgatgcatgcacgtgaaaaatgggcattt
Chromosome : 3
Position de début : 1267
Position de fin : 1317
Voir sur JBrowse

Commander