Ressources

Ressource: Mutant insertion KANMX 181

Ressource


Nom de la ressource : Mutant insertion KANMX 181

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta02g01500

Voir cette cible sur JBrowse
Lien :
Séquence début :
cggtaccactgacccgaacgctctgtgtgaggcgagcgcagcgtcgccggttcgcaaacgtgctcgagagagacgtccgtactgcagg
Chromosome : 2
Position de début : 337773
Position de fin : 337860
Voir sur JBrowse
Séquence transgene :
caaggcggcccgcaagtccgccccggcgaccggcggcgtcaagaagccgca
Chromosome : 2
Position de début : 1507
Position de fin : 1557
Voir sur JBrowse

Commander