Ressources

Ressource: Mutant insertion KANMX 176

Ressource


Nom de la ressource : Mutant insertion KANMX 176

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta19g00640

Voir cette cible sur JBrowse
Lien :
Séquence début :
gttctcgcgcgcgatgacgttgggtcgacgcgcgtcgaaaaaacgcgccgc
Chromosome : 19
Position de début : 157075
Position de fin : 157125
Voir sur JBrowse
Séquence transgene :
aactggctgacggaatttatgcctcttccgaccatcaagcattttatccgt
Chromosome : 19
Position de début : 798
Position de fin : 848
Voir sur JBrowse

Commander