Ressources

Ressource: Mutant insertion KANMX 146

Ressource


Nom de la ressource : Mutant insertion KANMX 146

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta01g04580

Voir cette cible sur JBrowse
Lien :
Séquence début :
ggcgccgtgggcgttcacggagagcgggttggcgctcggcgcggcgctcgc
Chromosome : 1
Position de début : 731873
Position de fin : 731923
Voir sur JBrowse
Séquence transgene :
ccgccggtcgccggggcggacttgcgggccgccttggtggcgagttgcttg
Chromosome : 1
Position de début : 1492
Position de fin : 1542
Voir sur JBrowse

Commander