Ressources

Ressource: Mutant insertion KANMX 135

Ressource


Nom de la ressource : Mutant insertion KANMX 135

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta08g00030

Voir cette cible sur JBrowse
Lien :
Séquence début :
catcgatggcacccacgacggatgcgtacgcgtgctgcaaccacggctgcg
Chromosome : 8
Position de début : 6515
Position de fin : 6565
Voir sur JBrowse
Séquence transgene :
gtgtatgaccccctgctttcgaactcaccgactcaccggcgcgcgcggtg
Chromosome : 8
Position de début : 1342
Position de fin : 1391
Voir sur JBrowse

Commander