Ressources

Ressource: Mutant insertion KANMX 127

Ressource


Nom de la ressource : Mutant insertion KANMX 127

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta01g00610

Voir cette cible sur JBrowse
Lien :
Séquence début :
gaacgcggagagcgagaagaagaatcgggtgcgagtggacatctcggagta
Chromosome : 1
Position de début : 88184
Position de fin : 88234
Voir sur JBrowse
Séquence transgene :
gtgtatgaccccctgctttcgaactcaccgactcaccggcgcgcgcggtga
Chromosome : 1
Position de début : 1342
Position de fin : 1392
Voir sur JBrowse

Commander