Ressources

Ressource: HAPT LUC insertion aléatoire 433

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 433

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta15g01440

Voir cette cible sur JBrowse
Lien :
Séquence début :
ggagagggcccgctcggagcgacgcgcgtggacgagccacgcgccgaacgt
Chromosome : 15
Position de début : 232493
Position de fin : 232543
Voir sur JBrowse
Séquence transgene :
cttaagccatgggaattcactggccgtcgttttacaacgtcgtgactggga
Chromosome : 15
Position de début : 55
Position de fin : 105
Voir sur JBrowse

Commander