Ressources

Ressource: HAPT LUC insertion aléatoire 431

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 431

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta12g02490

Voir cette cible sur JBrowse
Lien :
Séquence début :
ggcgtgcgagttggaggaggagttgggcgtgcgattgagcgatgcgaggcg
Chromosome : 12
Position de début : 398578
Position de fin : 398628
Voir sur JBrowse
Séquence transgene :
ggccgccttggtggcgagttgcttgcgcggggccttgcccccggtggactt
Chromosome : 12
Position de début : 3513
Position de fin : 3563
Voir sur JBrowse

Commander