Ressources

Ressource: HAPT LUC insertion aléatoire 430

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 430

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta12g00520

Voir cette cible sur JBrowse
Lien :
Séquence début :
atgcgaccgtcaataccggcgaggtcaccgacttcctgcgcggcgtgtgct
Chromosome : 12
Position de début : 74059
Position de fin : 74109
Voir sur JBrowse
Séquence transgene :
accggattcagtcgtcactcatggtgatttctcacttgataaccttatttt
Chromosome : 12
Position de début : 2495
Position de fin : 2545
Voir sur JBrowse

Commander