Ressources

Ressource: HAPT LUC insertion aléatoire 426

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 426

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta11g00480

Voir cette cible sur JBrowse
Lien :
Séquence début :
gcgttgccattgccacgagcggcgacgtgtacgtcgcaaaagctcttcgag
Chromosome : 11
Position de début : 104923
Position de fin : 104973
Voir sur JBrowse
Séquence transgene :
tgtgaaatgaactttttacccctataatttcatgggtcgtgactcgcacgg
Chromosome : 11
Position de début : 3205
Position de fin : 3255
Voir sur JBrowse

Commander