Ressources

Ressource: HAPT LUC insertion aléatoire 424

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 424

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta09g01360

Voir cette cible sur JBrowse
Lien :
Séquence début :
ggcgcggtgggcgcgggaatggtgaagatgggaataaaacccggaccgacg
Chromosome : 9
Position de début : 200641
Position de fin : 200691
Voir sur JBrowse
Séquence transgene :
atcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacg
Chromosome : 9
Position de début : 2626
Position de fin : 2677
Voir sur JBrowse

Commander