Ressources

Ressource: HAPT LUC insertion aléatoire 422

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 422

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta08g01960

Voir cette cible sur JBrowse
Lien :
Séquence début :
gtggagcaagaatcccgacggtgtcggtttcaaacttcgaggccagtcgta
Chromosome : 8
Position de début : 333094
Position de fin : 333144
Voir sur JBrowse
Séquence transgene :
aacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcct
Chromosome : 8
Position de début : 2590
Position de fin : 2640
Voir sur JBrowse

Commander