Ressources

Ressource: HAPT LUC insertion aléatoire 420

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 420

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta07g02970

Voir cette cible sur JBrowse
Lien :
Séquence début :
gcccccgaacacgccgaagaacctcgcgcccatgtcagtgaaaatgctcac
Chromosome : 7
Position de début : 449833
Position de fin : 449883
Voir sur JBrowse
Séquence transgene :
cttgcccccggtggacttacgggcagtttgctttgtacgggccatattgac
Chromosome : 7
Position de début : 3480
Position de fin : 3530
Voir sur JBrowse

Commander