Ressources

Ressource: HAPT LUC insertion aléatoire 418

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 418

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta06g02840

Voir cette cible sur JBrowse
Lien :
Séquence début :
cgacaccgcgcgcgatgtcctcgtttgcgctggttttgattatccatcgcc
Chromosome : 6
Position de début : 475241
Position de fin : 475291
Voir sur JBrowse
Séquence transgene :
gagtttgaaagcagggggtcatacacgagtcattactctctatttacttga
Chromosome : 6
Position de début : 3364
Position de fin : 3414
Voir sur JBrowse

Commander