Ressources

Ressource: HAPT LUC insertion aléatoire 417

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 417

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta05g00810

Voir cette cible sur JBrowse
Lien :
Séquence début :
attactcgtattcgattgcatcaatccaaagggacgtacaagaaggctcga
Chromosome : 5
Position de début : 111561
Position de fin : 111611
Voir sur JBrowse
Séquence transgene :
atgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctat
Chromosome : 5
Position de début : 3729
Position de fin : 3779
Voir sur JBrowse

Commander