Ressources

Ressource: HAPT LUC insertion aléatoire 396

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 396

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta16g01850

Voir cette cible sur JBrowse
Lien :
Séquence début :
cggtgaacaacgggcgatgccggtcgggttttacgacgatttcgtagattt
Chromosome : 16
Position de début : 278792
Position de fin : 278842
Voir sur JBrowse
Séquence transgene :
atgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatg
Chromosome : 16
Position de début : 2919
Position de fin : 2969
Voir sur JBrowse

Commander