Ressources

Ressource: HAPT LUC insertion aléatoire 388

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 388

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta13g01450

Voir cette cible sur JBrowse
Lien :
Séquence début :
gccgggacactacgcggcgagtaagggacacgcgtcggtgttggagaaact
Chromosome : 13
Position de début : 243028
Position de fin : 243078
Voir sur JBrowse
Séquence transgene :
tttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcact
Chromosome : 13
Position de début : 2572
Position de fin : 2622
Voir sur JBrowse

Commander