Ressources

Ressource: HAPT LUC insertion aléatoire 386

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 386

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta13g01330

Voir cette cible sur JBrowse
Lien :
Séquence début :
gcaaggcgtcgagcgcacgagcgacgggtttgagctgacgtttctcaagcg
Chromosome : 13
Position de début : 222016
Position de fin : 222066
Voir sur JBrowse
Séquence transgene :
gagagtaatgactcgtgtatgaccccctgctttcaaactcaccgactcacc
Chromosome : 13
Position de début : 3375
Position de fin : 3425
Voir sur JBrowse

Commander