Ressources

Ressource: HAPT LUC insertion aléatoire 385

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 385

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta12g02840

Voir cette cible sur JBrowse
Lien :
Séquence début :
cgccgtcgtcgggttgccgtcgaaacgcgcgcgagaccaggagacgatcga
Chromosome : 12
Position de début : 458862
Position de fin : 458912
Voir sur JBrowse
Séquence transgene :
tcatctgcccagatgcgaagttaagtgcgcagaaagtaatatcatgcgtca
Chromosome : 12
Position de début : 2119
Position de fin : 2169
Voir sur JBrowse

Commander